Моби клип с инопланетянами: ТОП-10 клипов Moby: altereos — LiveJournal

Содержание

ТОП-10 клипов Moby: altereos — LiveJournal

Бритоголовый композитор и исполнитель Ричард Мелвилл Холл, более известный как Моби, в конце 90-х совершил прорыв в области популярной электронной музыки. Лучшие его клипы, вошедшие в "золотой фонд" MTV и других музыкальных каналов, выходили именно в тот период. Большинство видеоработ музыканта отличаются сентиментальностью, задумчивостью, печальными сюжетами, хотя экшн и жесткость также иногда присутствуют в его клипах. Количество музыкальных клипов Моби за всё время не поддается подсчету - наверное, их около 70-ти. Я выбрал десятку самых лучших, на мой взгляд.

10 место: Porcelain (2000)
Конфликт внутренней безмятежности лирического героя и внешней суетливости окружающего мира - один из любимых сюжетов Moby, и в песнях, и в клипах. Клип "Porcelain" в этом плане является программным и типичным по настроению для музыканта в конце 90-х, в самый успешный его период. В музыкальном видео Моби сидит на заднем сиденье автомобиля, который сам по себе, без водителя, едет вперед, чудом избегая ДТП и различных опасных препятствий.

Когда камера поворачивается в сторону исполнителя, мы видим безразличное выражение его лица, хотя в любой момент машина может рухнуть в пропасть или столкнуться с каким-нибудь грузовиком - ну и ладно, жизнь есть тлен.
Смотреть клип на Youtube.

9 место: Come On Baby (1996)
Если хотите посмотреть Моби в "хулиганском" образе, ищите его ранние клипы. В Come On Baby он в образе пациента психбольницы в компании таких же буйных. Пока санитары спят, банда психов во главе с Моби учиняют разгром и крушат музыкальные инструменты (видимо, местной рок-группы). Клип пропитан энергией деструктива. Возможно, для кого-то станет сюрпризом, что Моби исполнял и такие композиции в жестком рóковом стиле - этот товарищ на самом деле перепробовал множество стилей.
Смотреть клип на Youtube.

8 место: Bodyrock (1999)
Малобюджетный, но очень энергичный клип, главный герой - молодой уличный танцор, исполняющий неистовый танец под композицию Моби. Сам автор безэмоционально наблюдает за этим душераздирающим зрелищем и периодически усиливает энергетику танца, включая с помощью специального аппарата искусственный дождь и искусственный ветер.

В какой-то момент поджигает какой-то мусор рядом, огонь перекидывается на чужой автомобиль, тот взрывается - всем пофиг.
Смотреть клип на Youtube.

7 место: James Bond Theme (1997)
В этом клипе Моби решил изобразить Джеймса Бонда - композиция как раз вошла в саундтрек к новой главе бондианы "Завтра не умрет никогда". Не знаю, как вам, но по мне из Моби получился худший Бонд в истории. Бегает-то он быстро и от грузовиков ловко уворачивается, но делает это с таким унылым выражением лица, словно его заставили мусор вынести. Полагаю, такова концепция клипа и образа Моби в целом, о котором я уже говорил выше: внутренняя безмятежность против внешней суеты.
Смотреть клип на Youtube.

6 место: Find My Baby (2000)
Самый забавный клип Moby, ироничная история про вымышленную рок-группу под названием Y-mob, участники которой после быстрой славы начинают вести себя как избалованные звезды шоу-бизнеса. Прикол в том, что музыканты эти - младенцы, которые еще и на ногах стоять не умеют (на видео видно, что их придерживают сверху, словно марионеток).


Смотреть клип на Youtube.

5 место: Why Does My Heart Feel So Bad? (1999)
Один из многих анимированных клипов Moby, в некоторых из них появляются одни и те же персонажи - в данном случае, обитатели Луны - мальчик по имени Маленький Идиот (альтер-эго Моби) и его собачка. Мальчик с собачкой, устав от лунного одиночества, спускаются на Землю, быстро разочаровываются в земной суете и возвращаются обратно в свой безмятежный лунный мирок.
Смотреть клип на Youtube.

4 место: Everytime You Touch Me (1995)
В середине 90-х Моби не был таким печальным и задумчивым, а наоборот, был очень драйвовым и активным, подтверждение тому - этот клип, выполненный в поздненововолновой эстетике, утверждающей творческую свободу и сексуальную раскрепощенность. Такой клип больше бы подошел группе Pet Shop Boys конца 80-х. Видео отличается сверхдинамичным монтажом: множество ярких образов быстро сменяют друг друга, такое зрелище захватывает дух.
Смотреть клип на Youtube.

3 место: Dream About Me (2005)
Моби любит истории о маленьких одиноких существах - видимо, он сам себя таковым и ощущает. Dream About Me - история о котятах-пришельцах. Однажды в городе приземляется летающая тарелка (этот сюжетный прием часто встречается в клипах музыканта), из него выпрыгивают котята, прохожие быстро их разбирают - кроме одного. Одинокий котенок бродит по городу, никто его не подбирает, в финале он смиряется с своим одиночеством.
Смотреть клип на Youtube.

2 место: In This World (2002)
История в том же духе: миниатюрные мультяшные инопланетяне прилетают за Землю с целью установить контакт с homo sapiens. В их лапках таблички с словом "привет" на разных языках. Пришельцы бегают по Нью-Йорку в поисках общения, но никто их не замечает, включая самого Моби. В результате они возвращаются назад на свою планету ни с чем. Вот такое бездушное и нечуткое у нас общество, с точки зрения музыканта.
Смотреть клип на Youtube.

1 место: Natural Blues (2000)
Самый трогательный клип Моби, клип-слезовыжималка.

Постаревший (с помощью грима) Моби попадает в дом престарелых, там он листает альбом со своими старыми фотографиями, вспоминает свою славную жизнь. В определенный момент является ангел смерти в облике актрисы Кристины Риччи и уносит нашего героя на тот свет. Композиция сама по себе тоскливая, при этом очень красивая и "глубокая", одна из самых известных у Moby, видеоряд отлично подчеркивает ее настроение.
Смотреть клип на Youtube.

ТОП-10 клипов Moby | ALTEREOS

Бритоголовый композитор и исполнитель Ричард Мелвилл Холл, более известный как Моби, в конце 90-х совершил прорыв в области популярной электронной музыки. Лучшие его клипы, вошедшие в "золотой фонд" MTV и других музыкальных каналов, выходили именно в тот период. Большинство видеоработ музыканта отличаются сентиментальностью, задумчивостью, печальными сюжетами, хотя экшн и жесткость также иногда присутствуют в его клипах. Количество музыкальных клипов Моби за всё время не поддается подсчету - наверное, их около 70-ти. Я выбрал десятку самых лучших, на мой взгляд.

10 место: Porcelain (2000)
Конфликт внутренней безмятежности лирического героя и внешней суетливости окружающего мира - один из любимых сюжетов Moby, и в песнях, и в клипах. Клип "Porcelain" в этом плане является программным и типичным по настроению для музыканта в конце 90-х, в самый успешный его период. В музыкальном видео Моби сидит на заднем сиденье автомобиля, который сам по себе, без водителя, едет вперед, чудом избегая ДТП и различных опасных препятствий. Когда камера поворачивается в сторону исполнителя, мы видим безразличное выражение его лица, хотя в любой момент машина может рухнуть в пропасть или столкнуться с каким-нибудь грузовиком - ну и ладно, жизнь есть тлен.
Смотреть клип на Youtube.

9 место: Come On Baby (1996)
Если хотите посмотреть Моби в "хулиганском" образе, ищите его ранние клипы. В Come On Baby он в образе пациента психбольницы в компании таких же буйных. Пока санитары спят, банда психов во главе с Моби учиняют разгром и крушат музыкальные инструменты (видимо, местной рок-группы).

Клип пропитан энергией деструктива. Возможно, для кого-то станет сюрпризом, что Моби исполнял и такие композиции в жестком рóковом стиле - этот товарищ на самом деле перепробовал множество стилей.
Смотреть клип на Youtube.

8 место: Bodyrock (1999)
Малобюджетный, но очень энергичный клип, главный герой - молодой уличный танцор, исполняющий неистовый танец под композицию Моби. Сам автор безэмоционально наблюдает за этим душераздирающим зрелищем и периодически усиливает энергетику танца, включая с помощью специального аппарата искусственный дождь и искусственный ветер. В какой-то момент поджигает какой-то мусор рядом, огонь перекидывается на чужой автомобиль, тот взрывается - всем пофиг.
Смотреть клип на Youtube.

7 место: James Bond Theme (1997)
В этом клипе Моби решил изобразить Джеймса Бонда - композиция как раз вошла в саундтрек к новой главе бондианы "Завтра не умрет никогда". Не знаю, как вам, но по мне из Моби получился худший Бонд в истории. Бегает-то он быстро и от грузовиков ловко уворачивается, но делает это с таким унылым выражением лица, словно его заставили мусор вынести. Полагаю, такова концепция клипа и образа Моби в целом, о котором я уже говорил выше: внутренняя безмятежность против внешней суеты.

Смотреть клип на Youtube.

6 место: Find My Baby (2000)
Самый забавный клип Moby, ироничная история про вымышленную рок-группу под названием Y-mob, участники которой после быстрой славы начинают вести себя как избалованные звезды шоу-бизнеса. Прикол в том, что музыканты эти - младенцы, которые еще и на ногах стоять не умеют (на видео видно, что их придерживают сверху, словно марионеток).
Смотреть клип на Youtube.

5 место: Why Does My Heart Feel So Bad? (1999)
Один из многих анимированных клипов Moby, в некоторых из них появляются одни и те же персонажи - в данном случае, обитатели Луны - мальчик по имени Маленький Идиот (альтер-эго Моби) и его собачка. Мальчик с собачкой, устав от лунного одиночества, спускаются на Землю, быстро разочаровываются в земной суете и возвращаются обратно в свой безмятежный лунный мирок.


Смотреть клип на Youtube.

4 место: Everytime You Touch Me (1995)
В середине 90-х Моби не был таким печальным и задумчивым, а наоборот, был очень драйвовым и активным, подтверждение тому - этот клип, выполненный в поздненововолновой эстетике, утверждающей творческую свободу и сексуальную раскрепощенность. Такой клип больше бы подошел группе Pet Shop Boys конца 80-х. Видео отличается сверхдинамичным монтажом: множество ярких образов быстро сменяют друг друга, такое зрелище захватывает дух.
Смотреть клип на Youtube.

3 место: Dream About Me (2005)
Моби любит истории о маленьких одиноких существах - видимо, он сам себя таковым и ощущает. Dream About Me - история о котятах-пришельцах. Однажды в городе приземляется летающая тарелка (этот сюжетный прием часто встречается в клипах музыканта), из него выпрыгивают котята, прохожие быстро их разбирают - кроме одного. Одинокий котенок бродит по городу, никто его не подбирает, в финале он смиряется с своим одиночеством.

Смотреть клип на Youtube.

2 место: In This World (2002)
История в том же духе: миниатюрные мультяшные инопланетяне прилетают за Землю с целью установить контакт с homo sapiens. В их лапках таблички с словом "привет" на разных языках. Пришельцы бегают по Нью-Йорку в поисках общения, но никто их не замечает, включая самого Моби. В результате они возвращаются назад на свою планету ни с чем. Вот такое бездушное и нечуткое у нас общество, с точки зрения музыканта.
Смотреть клип на Youtube.

1 место: Natural Blues (2000)
Самый трогательный клип Моби, клип-слезовыжималка. Постаревший (с помощью грима) Моби попадает в дом престарелых, там он листает альбом со своими старыми фотографиями, вспоминает свою славную жизнь. В определенный момент является ангел смерти в облике актрисы Кристины Риччи и уносит нашего героя на тот свет. Композиция сама по себе тоскливая, при этом очень красивая и "глубокая", одна из самых известных у Moby, видеоряд отлично подчеркивает ее настроение.
Смотреть клип на Youtube.

.

Moby | KRUGA.NET

Еще немного из истории...
Когда Моби было 2 года, в автомобильной аварии погиб его отец. С тех пор мальчика воспитывала мама, достаточно прогрессивная женщина, которая поощряла все его музыкальные начинания.

В 13 лет мальчик начал осваивать гитару, затем басс, барабаны и клавишные. Двумя годами спустя Моби уже играл в местной панк-группе.

Его любовь к музыке была настолько велика, что это начинают замечать окружающие. Поначалу Моби играет в ночных клубах, чем чрезвычайно радует их посетителей и владельцев. Кого больше, непонятно.

В 1983 году он оканчивает школу и вместе с малоизвестной группой Vatican Commandos выпускает свой первый сингл, который носит название «Hit Squad For God». Далее - университет, о котором Моби забывает спустя год.

В 1990 году он попадается на глаза представителям Instinct Records и возвращается в Нью-Йорк. «Я вспоминаю свою квартиру. Это была темная и грязная лачуга рядом с каким-то мексиканским рестораном, который работал 24 часа в сутки и, похоже, заодно был и секс-шопом и борделем», - вспоминает Моби.

В период с 1990 по 1995 год музыкант выпускает три альбома - «Moby» (1992), «Early Underground»(1993) и «Ambient»(1993), синглы из которых достигают значительного успеха.

В 1994 году, в 29-летнем возрасте Моби вместе с Orbital и Aphex Twin отправляется в турне по Северной Америке. Стоит отметить, что этот тур не был для него очень веселым. «Меня все ненавидели, хотя я ничего плохого не сделал и ко всем относился хорошо. Ладно, чего уж там... Не будем вспоминать о грустном», - делится композитор своими переживаниями.

Вскоре Моби подписывает двойной контракт - один с европейским лейблом Mute Records, а второй с компанией Elektra. Весной 1995 года выходит его четвертый альбом «Everything Is Wrong», который, кстати, музыкант считает своим первым настоящим произведением. Альбом представляет все разнообразие стилей, и тем самым показывает универсальность мышления и неподдельный талант Моби. Известное музыкальное издание Spin называет этот диск альбомом года.

В этом же году он выступает на фестивале Lollapalooza, где его партнерами по сцене являются ребята из RHCP. За фестивалем в жизни музыканта начинается черная полоса.

В 1996 году выходит альбом «Animal Rights». Автору нравится проделанная работа - в этом произведении он неожиданно отошел от электронных ритмов и приблизился к хард-року. Кроме того, здесь Моби впервые представил слушателям свои вокальные данные. В довесок к «Animal Rights» ограниченным тиражом выходит диск под названием «Little Idiot», где он собирает легкую симфоническо-инструментальную музыку.

К большому сожалению, его восторг не разделяет ни пресса, ни слушатели. «Animal Rights» продается плохо! На этой почве у Моби развивается депрессия. Вдобавок ко всему от рака легких умирает его мать.

В 1997 году Моби собирается с силами и выпускает альбом-компиляцию «I Like To Score», где собирает композиции, которые он создал для различных кинофильмов.

В мае 1999 выходит «Play» - пожалуй, самое успешное творение уже очень знаменитого электронщика. Альбом расходится небывалым тиражом и достигает статуса «платинового» более чем в 20 странах!

На время Моби выходит из игры. Но, несмотря на этот тайм-аут, его не забывают, что иногда случается с музыкантами, которые выпадают из поля зрения публики.

Он готовит новый альбом, в создании которого ему помогают Шинед О'Коннор и Энжи Стоун. И вот, наконец, 13 мая 2002 года музыкант имеет честь представить свой новый альбом под названием «18».

Моби (настоящее имя Ричард Мелвилл) является внуком знаменитого писателя Германа Мелвилла, написавшего классическую новеллу "Моби Дик". Отсюда и прозвище, которого мальчика наградили еще в начальной школе.

Суперпопулярным Моби сделал его альбом 2000-го года "Play", содержавший хит "Natural Blues", и достигший статуса "платинового" в 20-ти странах мира.

Моби - убежденный вегетарианец и гринписовец.

 

Клипы moby в формате mp4 @ gzxrtcz的部落格 :: 痞客邦 ::

Клипы moby в формате mp4

Link: Скачать Клипы moby в формате mp4

Информация о файле:
Добавлен: 01.05.2015
Скачали: 260
Рейтинг: 55 из 1423
Скорость загрузки: 23 Mbit/s
Файлов в категории: 50

Смотреть клипы Moby и скачать других 732 видеороликов исполнителя - Moby. Myhit.kz несомненно поможет для вас загрузить клипы в формате mp4Смотреть онлайн клип moby с цыпленком mp4 видео в высоком или Скачать клип moby с цыпленком в формате full hd mp4, 3gp, flv, 1080p hq без

Тэги: в moby mp4 формате клипы

Недавние поисковые запросы:

напровление в музыке dubstep

мультики без регистрации и смс

музыку виктории победительници

Moby, все клипы онлайн. Скачать клипы Moby бесплатно в формате mp4, flv, webm. 1 авг. 2009 г. - Скачайте клип Moby - Natural Blues в формате mp4 по одной из появившихся ссылок. >>> Скачать клип Moby - Natural Blues смотреть 29 янв. 2013 г. - Исполнитель: Moby Название: Everloving Продолжительность: 00:03:38 stereo 1411Kbps Формат: MP4 Размер: 54 Mb Скачать клип :

клип фантом чиж

Смотреть онлайн клип моби с инопланетянами mp4 видео в высоком или низком Скачать клип моби с инопланетянами в формате full hd mp4, 3gp, flv, Moby - Extreme Ways: нажмите, чтобы скачать клип бесплатно и без Смотреть видео онлайн в хорошем качестве, скачать в HD формате mp4 - для Скачать бесплатно клипы moby disko lies в формате mp4. Прорыв Сколковских генетиков: теперь клонированная овечка может не только блеять, но и У нас можно не только посмотреть данный клип онлайн, проголосовать за но и есть возможность скачать клип Moby - The Only Thing в формате mp4. clips, videous. Moby — Extreme Ways Nicole Scherzinger — Whatever U Like Roger Sanchez — Another Chance Video BitRate 170kb/ps. Format mp4.


мелодии сериалов
Игры торрент, Леди гага бэд романс клип, Фильм форсаж, Контрольные срезы по математике 4 класса, Этническая музыка с vip-file.

VI. Технология образа: ars chimaera

Джо Дэвис ::: Биография МОНСТРЫ, КАРТЫ, СИГНАЛЫ И КОДЫ Натурализм в искусстве Многочисленные сохранившиеся наскальные рисунки и петроглифы эпохи неолита (изображения человека, животных, сцен войны и охоты) свидетельствуют о том, что стремление художника к натурализму зародилось практически одновременно с самыми первыми попытками художественного творчества. В искусстве древних цивилизаций Средиземноморья и Леванта можно выделить несколько этапов, характеризующих последовательный рост интереса людей к "истинному" познанию строения человеческого тела. Древние греки, достигнув определенной степени "истинности" в своих познаниях анатомических особенностей человека, обратили внимание уже на "сокровенные" тайны жизни. Они установили соотношения отдельных частей человеческого тела и вычислили т.н. "золотую пропорцию", принципы которой, в свою очередь, нашли широкое применение в математике, архитектуре и астрономии. Именно руководствуясь моделью "золотого сечения", Иоганн Кеплер (может быть, по наитию или счастливому стечению обстоятельств) создал удивительно точные астрономические таблицы и открыл законы движения планет вокруг Солнца. Трансанимация в истории искусства (некоторые примеры) Свидетельства о волшебных или божественных взаимопревращениях - "трансанимации" (от лат. animus - "душа", animatus - "одушевленный") всех форм живой и неживой материи - являются важной составной частью греко-романской и иудео-христианской традиций. Обе занимают исключительное место в хронике человеческого преклонения перед силой и могуществом энергии, разделяющей жизнь и смерть. Данная электронная версия книги "Биомедиале. Современное общество и геномная культура" не полна. Текст без пропусков может быть приобретен в печатной форме в виде антологии. Запрос направлять по адресу: 236000, Россия, г. Калининград, ул. К.Маркса, 18, по телефонам: Калининград (0112)216251, Санкт-Петербург (812)3885881, Москва (095)2867666. Электронный магазин: http://www.yantskaz.ru, Книга-почтой: тел.(0112)216251, все справки по электронному адресу: [email protected] Полная ссылка на данную книгу: "Биомедиале. Современное общество и геномная культура". Составление и общая редакция Дмитрия Булатова. Калининград: КФ ГЦСИ, ФГУИПП «Янтарный сказ», 2004. Архетипы Мумии, Человека-волка, Дракулы и Франкенштейна в сознании людей всегда занимали особое место благодаря их связям с потусторонними силами, что предполагало дополнительную власть над жизнью и смертью. Эта тема послужила отправной точкой для появления несметного количества произведений в области современного искусства, литературы и кинематографа. В 1986 г. при помощи синтезированной ДНК и генетически модифицированных бактерий было создано первое художественное произведение. Пришельцы и монстры Наиболее ярким примером наличия "трансанимационных" верований в современной жизни можно считать организацию систематического научного поиска внеземного разума. Человеческим надеждам нет предела; мы полагаем, что даже если просто зададимся этим вопросом, уже сможем оживить целую вселенную. И здесь наше воображение идет проторенным путем, возвращаясь на круги давно известных тем. Массовая истерия, нагнетаемая СМИ по поводу похищений землян инопланетянами, красноречиво свидетельствует о том, что общественное сознание насквозь проникнуто проблемами сексуального характера, где страх и предвкушение сплетаются воедино. Основа сюжетной интриги трансанимационных историй целиком выстраивается на отношениях сексуально-романтического свойства кошмарных чудищ с человеческими существами. И как всегда вдруг выясняется, что современные монстры - не что иное, как наши собственные отражения, родственные "классическим" чудовищам, уже архивированным в качестве примеров клинической патологии. Это вносит некоторую ясность в психологический портрет Капитана Кирка из "Звездного пути", периодически вступающего в романтические отношения с представительницами различных внеземных рас. Казалось бы, комбинированные существа (по типу - полулюди-полуживотные) древнеегипетского пантеона, критский Минотавр, кентавры Греции и Рима предвосхитили призрак межвидового монстра, преследующего современное анти-генетическое лобби и активистов, озабоченных генетически модифицированными продуктами. Однако если вдуматься, идея химерности имеет гораздо более глубокие корни: межвидовые существа уже давно прописаны в нашей жизни в различных, порой даже неожиданных формах. Например, Homo sapiens имеет множество общих генов с остальным живым миром Земли. Мы, человеческие существа, независимо от того, насколько бы уникальными и одаренными себя ни воображали, имеем 70%-процентную гомологию наших генов генам помидоров (при этом сходство генов Homo sapiens, шимпанзе и человекообразных обезьян вообще приближается к 99%). Не заметить тот факт, что пришельцы и монстры уже до отказа заполонили нашу планету, довольно легко. Они многочисленны, вездесущи, инкогнито и большинство из них имеет отношение к продуктам питания. Начиная с доисторических этапов развития земледелия, человек только тем и занимался, что формировал геномы различных биологических видов в соответствии со своими генетическими предпочтениями. На сегодняшний день практически все виды, задействованные в сельскохозяйственном производстве, в той или иной степени претерпели изменения на генетическом уровне. В качестве иллюстрации достаточно взять самый обыкновенный помидор из магазина "натуральных продуктов" - "чистый" овощ, выращенный без использования пестицидов или химических удобрений. Но даже этот, на первый взгляд, "незапятнанный" биотехнологиями помидор в полной мере является "монстром" согласно словарному определению этого понятия. (Процитировать?). Современный томат обладает значительно бoльшим количеством копий хромосом, нежели его американские предки-ягоды с естественным набором. Дополнительные ДНК нынешних культур томата указывают на усиленную трансляцию генов, обусловившую гигантские размеры современного плода по сравнению с исходным. Итак, однажды, давным-давно, мы создали помидор-великан. При этом способ модификации плода не имеет принципиального значения, будь это традиционное садоводство, использование мутагенных агентов или рекомбинантные методы молекулярной биологии. Результат один и налицо: помидор - это "монстр". Просто большинство из нас об этом не догадывается. Даже роза до известной степени - Франкенштейн, ибо ее геном состоит из частей и фрагментов геномной структуры множества других подвидов роз. Это же относится и к различным видам декоративных растений и несъедобных организмов, модифицированных Homo sapiens'ом для улучшения их эстетических свойств или при достижении каких-либо других целей. На протяжении долгого времени человек был не только создателем такого рода чудовищ, но и самым настоящим "фагом" и/или потребителем своих творений. Одновременно с утолением голода он косвенным образом модифицировал и свой собственный организм. Сегодня, если бы мы употребляли в пищу "предков" тех видов животных и растений, которые едим в наше время, для выживания нашим организмам потребовалось бы серьезное генетическое "переоснащение". Нам пришлось бы просто дополнить свою "программу" фенотипами ранних гоминидов для того, чтобы обеспечить усвоение этой органики. Сами толком не разобравшись, кто такие монстры, нынче мы уже вводим в заблуждение и Чужих на этот счет. Поиск Намеренно или нет, но в качестве "визитной карточки" нашего биологического вида мы отправляли в космос до странности некорректные изображения. Послания, выгравированные на позолоченных пластинах-носителях, были запущены за пределы солнечной системы при помощи межпланетных зондов "NASA Пионер" и "Вояджер". Эти эксперименты считаются первыми серьезными научными попытками установления контакта с внеземными цивилизациями. "NASA Пионер" и "Вояджер", стартовавшие в начале и середине 70-х годов, смогли развить достаточную скорость, чтобы выйти за пределы солнечной системы при помощи гравитационного поля Юпитера. Это самые скоростные баллистические объекты, созданные на сегодняшний день руками человека: сейчас они удаляются от нас со скоростью около 50 тыс.км./час, что во много раз превышает скорость пули. Пластины "Пионера" содержат набор визуальной информации, включающей элементарную карту солнечной системы, траекторию корабля, схему квазизвездных объектов, называемых "пульсарами" (нечто вроде путеводителя для любопытных инопланетян по окрестностям солнечной системы), изображение самого зонда "Пионер" и два контурных тиснения, символизирующих мужчину и женщину Homo sapiens. Обе фигуры представляют усредненный тип белого европеоидного человека без признаков растительности на лице или теле. Мужская фигура делает таинственный жест рукой с открытой ладонью вверх и имеет "должным образом" отображенные гениталии. Внешние половые органы женщины (фигурка размером поменьше) красноречиво отсутствуют. Дабы усугубить ситуацию, при составлении посланий для двух зондов "Вояджер", последовавших за "Пионером" за пределы солнечной системы, NASA принимает решение полностью устранить даже эти изображения обнаженных человеческих существ. Естественно, что такая цензура вряд ли окажется в пользу пришельцев. Об инопланетянах мы знаем совсем не много. Однако, если "разум" где-то и существует как биологическая форма, мы можем быть практически уверены в одном: разумные существа обладают половыми различиями, так как без обмена генетическим материалом они не могут эволюционировать. В 1958 году Джошуа Ледерберг получил Нобелевскую премию за открытие половых различий у бактерий. Так, намеренно или волею судеб, мы умудрились отправить во Вселенную несколько посланий, которые чрезвычайно выразительно характеризуют нашу собственную предвзятость. Очевидные информационные пробелы в наших межзвездных посланиях наводят на мысль, что инопланетяне не имеют права знать, как мы выглядим. Может быть, именно поэтому нам не стоит так скептически относиться к сообщениям о похищениях людей пришельцами для экспериментов с их половыми органами? Наверное, это к лучшему, что одни из самых быстроходных космических кораблей в истории человечества, передвигающиеся со скоростью около 50 тыс. км./час, достигнут ближайшей звезды лишь через 100 000 лет. Ведь кроме рассылки позолоченных "бандеролей" существует и более эффективный способ доставки космических посланий. В 1974 году астрономы Фрэнк Дрейк и Карл Саган предприняли попытку передать на скорости света трехминутное сообщение в созвездие Геркулеса. Для этого они использовали уникальный параболический радиотелескоп мощностью миллион ватт, установленный в Аресибо, Пуэрто-Рико. Дрейк и Саган были убеждены, что именно двоичная система, благодаря своей простоте, должна быть наиболее распространенной формой квантования. Астрономы руководствовались тем, что если инопланетяне имеют представление о математике, им известны простые числа и так называемые "числа Цермело". Это ряд чисел, например, 35, которые делятся только на самих себя, 1 и два простых множителя (в нашем случае 5 и 7). При помощи радиотелескопа в Аресибо Дрейк и Саган передали 1679 нолей и единиц ("on" и "off"). 1679 - число Цермело, которое можно разложить только на него самого, единицу и простые множители 23 и 73. Таким образом, разумные инопланетяне могли бы сделать вывод, что поток 1679 бит должен составлять растровую сетку 23 на 73. Если придать "нулям" и "единицам" контрастные значения (например, "светлое" и "темное"), тогда в одном из нескольких возможных разложений потока в такую сетку появляется некое заданное изображение. Очередное допущение предполагало, что инопланетные коллеги истолкуют полученный рисунок именно так, как это было задумано земными авторами.

Interplanetary probe Pioneer message plaque.

Подобно пластинам "Пионера", зашифрованное послание Дрейка и Сагана содержало изображение средства передачи сообщения (параболическая радиоантенна), простейшую карту солнечной системы и силуэт человека. Радиоинформация из Аресибо также включала в себя схему правосторонней спирали ДНК, атомный вес пяти составляющих ее химических элементов, точное число оснований ДНК генома человека и численность населения Земли на 1974 год.

Launched in the early 1970's, NASA's Pioneer spacecraft acheived enough velocity to escape the solar system with an the assistance of the Jovian gravitaional field.

Послание в разных бутылках Вдохновившись аресибским экспериментом, я решил проверить эффективность подобного послания посредством инсталляции, которую выстроил в библиотеке Хайден Массачусетского технологического института (1989 г.). Художественное произведение под названием "Послание в разных бутылках" состояло из 1679 стеклянных бутылок Boston Round (16 унций), закрепленных в больших каркасах, и занимало 18 проходов книгохранилища, находящегося в подвале. Как и положено, "единицы" были наполнены водой, а "нули" - пустые. Хейден - одна из крупнейших библиотек Массачусетского технологического института. В ней есть вся информация, имеющая отношение к посланию, вся информация, необходимая для расшифровки послания, и, кроме того, ее часто посещают наиболее разумные из земных существ. Никто из них мое послание так и не расшифровал. Послания человека для установления контакта с внеземным разумом обладают обширным контекстом, однако в то же время они должны говорить и сами за себя. Аристотель понимал, что мы обязаны раскрыть самих себя самим себе прежде, чем раскрывать себя кому-либо другому. В "Поэтике" Аристотель назвал проблему самораскрытия основным элементом поэтики трагедии. Он дал этому принципу название "узнавание" ("переход от незнания к знанию"), который наряду с другим конструктивным моментом - "перепетией" - формирует сам предмет изображения трагедии. Действительно, зависимость трагедийного предмета от механизмов "узнавания" и "перепетии" определенно прослеживается на протяжении всей истории искусства и литературы. Проще говоря, "Ты обходишь всю Землю в поисках Чаши Грааля. По пути ты убиваешь собственную мать, попадаешь в тошнотворные переделки, претерпеваешь невыносимые мучения и тяжкие страдания. А в результате обнаруживаешь, что Чаша Грааля все это время находилась у тебя за пазухой". Это история "Джекила и Хайда". Это "Моби Дик", "Эдип", "Возвращение Мартина Герра", "Фицкаральдо", "Волшебник Изумрудного Города", "Быть Джоном Малковичем". И опять же - "другой" неотвратимо присутствует внутри. Куда бы мы ни пошли, что бы мы ни увидели, независимо, как далеко от мира, - мы находим только отражения. По Аристотелю, когда мы, в конце концов, доберемся до края Вселенной, то, вынырнув вниз головой, обнаружим, что там на стене отпечатана все та же кора головного мозга человека. Ученые, озабоченные поисками внеземного разума, продолжают старательно разрабатывать сложнейшие, детальные, но с практической точки зрения неприменимые цифровые сообщения для передачи по радиотелескопу иным цивилизациям. Универсальность языка, основанного на двоичном коде, вызывает сомнения по нескольким причинам. Во-первых, мы, создания билатерально* симметричные, существуем в мире множеством других симметрий. Мы погружены в традиции когнитивной дихотомии: правое и левое, позитив и негатив, правда и ложь, добро и зло. Если бы мы были радиально симметричными, то "универсальной" считали бы совсем иную форму математической экспрессии.

Frank Drake and Carl Sagan decided to use the million-watt radar transmitter at Arecibo, Puerto Rico to beam their message.

Во-вторых, ноль был изобретен на нашей планете всего около тысячи лет назад. Вполне возможно, что очень разумные существа, построившие в разное время Парфенон, акведуки и пирамиды, создавшие карты звездного неба и измерившие окружность Земли, сделали все это вовсе без нуля. И еще одно необоснованное предубеждение: ученые, полностью полагаясь на визуальную информацию (растровый массив или информационные пластины) как надежное средство межпланетной коммуникации, исходят из того, что инопланетяне обладают зрительными органами, способными воспринимать их послания. А наш земляк Кент Каллерс, сотрудник Института поиска внеземных цивилизаций в Калифорнии, много лет проработавший в NASA в поисках внеземного разума, - слеп. Poetica Vaginal В 1986 году, в целях установления контакта с внеземным разумом я организовал художественный проект, в рамках которого была сделана попытка передачи вагинальных сокращений в космос. Проект назывался "Poetica Vaginal". В нем участвовали художники, инженеры, электрики, биологи, астрономы, профессиональные танцоры, архитекторы, лингвисты и философы. В лаборатории приборостроения МТИ был создан так называемый "вагинальный детектор". Он состоял из заполненной водой пластиковой пробирки центрифугирования, установленной на жестком нейлоновом основании, содержавшем сверхчувствительный датчик. Приглашенные участники эксперимента - танцовщицы и другие женщины-волонтеры, соблюдая необходимые гигиенические нормы, инвагинировали детектор в целях регистрации вагинальных сокращений (наиболее высокая частота была зафиксирована на уровне 0,8 Hz). Установленный датчик обладал достаточной чувствительностью, чтобы уловить голос, биение сердца и дыхание, а также произвольные и непроизвольные вагинальные сокращения. Гармонические колебания вагинальных сокращений в реальном времени сопровождались трансляцией музыкальных композиций для того, чтобы частота сокращений совпала с конкретными частотами английской речи. Филолог, принимавший участие в проекте, "забитовал" звуковой строй языка (фонемы) таким образом, чтобы их можно было отобразить в реальном времени в соответствии с вагинальным "входным сигналом". Цифровое картирование выходного сигнала детектора осуществлялось в режиме реального времени. Таким образом, одновременно выходило три формы послания: 1) аналоговый сигнал, непосредственно генерированный вагинальными сокращениями; 2) цифровая карта этого явления и 3) голос ("фонетическая" карта вагинальных сокращений на частотах английского языка). Электрики выстроили управляющую цепь таким образом, чтобы "Poetica Vaginal" можно было транслировать через миллион ваттный Мильстонский радар Массачусетского технологического института, находящийся в обсерватории Хейстек (Гротон/Вестфорд, Массачусетс). Художники, архитекторы и инженеры обеспечили электронный и ручной контроль передачи сигнала "Модуля вагинального путешествия". Благодаря совместным стараниям участников проекта складная конструкция из стали, дерева, кабелей и упаковочного материала в результате выглядела как индейская баня, установленная на космическом модуле, спускаемом на Марс.

Artistic work constructed from synthetic molecules of DNA. The first of these artistic molecules, Microvenus, contains a coded visual icon representing the external female genitalia and by coincidence, an ancient Germanic rune representing the female Earth.

Астрономы и астрофизики выбрали 4 ближайших звездных аналога Солнца: Эпсилон Эридани, Тау Цети и две безымянные, обозначенные номерами каталога Королевской Гринвичской Обсерватории. Все они расположены на расстоянии от 10 до 40 световых лет от Земли. Координаты космических объектов были высчитаны таким образом, чтобы на них можно было направить радарный сигнал. Сам модуль был собран на площадке Обсерватории, где и прошла предварительная пробная передача вагинальных сигналов с одновременной их записью на аудиокассету. Однако накануне начала радиотрансляции "в живую" руководитель проекта, полковник ВВС США (Массачусетский институт заключил контракт с ВВС), наложил запрет на проведение работ… И все же нам удалось в течение нескольких минут осуществить передачу пробных сигналов на каждую из четырех звезд. Тихоходы и другие проблемы Сложности возникают не только при выполнении экспериментов на космических кораблях, но и при передаче сигнала через радиолокатор. В космосе нет мощных радиолокационных передатчиков, поэтому сигнал должен быть максимально сфокусирован для эффективного преодоления атмосферного "окна", насыщенного мельчайшими пылевыми частицами. Это значительно сужает диапазон частот передачи. Данная электронная версия книги "Биомедиале. Современное общество и геномная культура" не полна. Текст без пропусков может быть приобретен в печатной форме в виде антологии. Запрос направлять по адресу: 236000, Россия, г. Калининград, ул. К.Маркса, 18, по телефонам: Калининград (0112)216251, Санкт-Петербург (812)3885881, Москва (095)2867666. Электронный магазин: http://www.yantskaz.ru, Книга-почтой: тел.(0112)216251, все справки по электронному адресу: [email protected] Полная ссылка на данную книгу: "Биомедиале. Современное общество и геномная культура". Составление и общая редакция Дмитрия Булатова. Калининград: КФ ГЦСИ, ФГУИПП «Янтарный сказ», 2004. По причине технических ограничений радиолокационный сигнал может быть единовременно передан только на одну звезду. Для сравнения отметим, что только во Млечном Пути звезд больше, чем рыбы в океане. Предположим, мы решили выйти на рыбалку примерно на три минуты, питая большие надежды на успех. При этом наша оснастка рассчитана на поимку одной конкретной рыбы из всей океанской фауны. Понятно, что шансы у нас минимальны. Самая большая проблема при передаче высокоскоростных посланий внеземному разуму заключаются в том, что в этой ситуации не хватает даже скорости света. Диаметр Млечного Пути составляет около 100 000 световых лет. Путешествие от одной стороны галактики до другой и обратно на скорости света займет 200 000 лет. Митохондриальная Ева (от которой по некоторым данным произошли все человеческие существа) жила примерно 200 000 лет назад. Если бы у нее оказалось оборудование для передачи сигнала достаточной мощности и на нужной частоте на другую сторону нашей галактики, и этот сигнал был бы принят в нужный момент 100 000 лет назад внеземным разумом, который незамедлительно ответил, - то его послание еще в пути. Тем временем Ева благополучно эволюционирует в другие виды. Кстати, может быть, митохондриальная Ева вовсе не была Homo Sapiens. Радиолокационная антенна в Аресибо не обладает маневренностью, так как она встроена в полусферическую впадину кратера потухшего вулкана. Таким образом, окно выхода ее сигнала ограничено. Сагану и Дрейку пришлось выбирать цель из тех звезд, которые появлялись в этом окне в момент передачи космического послания. В результате послание из Аресибо было направлено на звездный кластер М13 в созвездии Геркулеса, находящегося на расстоянии примерно 25 000 световых лет. Итак, мы оказались в положении жениха с букетом цветов, ждущего в церкви свою невесту вот уже 50 000 лет: она все идет, идет и идет к нему, а он все ждет, ждет и ждет, чтобы сорвать с нее покров невинности. Воистину печальная картина... Помимо проблем с содержанием послания существует три основных технических сложности, которые возникают в каждом экспериментальном проекте по межзвездной коммуникации. Во-первых, для миллиардов потенциальных получателей сообщения необходимо создать миллиарды копий послания. Во-вторых, носитель должен быть достаточно прочным, чтобы выдержать жесткие условия космической среды, включая экстремальные температуры, радиацию и вакуум. В-третьих, целостность носителя из практических соображений не должна быть нарушаема в течение неограниченного периода времени (по крайней мере, периода, соразмерного с нашим понятием "геологического времени"). Эти проблемы связывают в одно целое безмерность макрокосмоса и бесконечную малость микрокосмоса и именно они вдохновили меня на первые художественные проекты в области молекулярной биологии. Так получилось, что только бактерии, особенно спорулирующие, замечательным образом отвечают всем выдвигаемым техническим требованиям. Они могут длительное, даже неограниченное время выживать в космических условиях. Кроме того, за один день можно без особых усилий и затрат произвести миллиарды идентичных копий одной бактерии. Микровенус В 1986 году два участника проекта "Poetica Vaginal" (я и Дана Бойд, генетик из Гарварда и молекулярный биолог) решили создать модельный бактериальный носитель интеллектуальной информации человека. Эта работа, которую мы назвали "Микровенус", стала первым произведением, созданным непосредственно в форме ДНК при помощи рекомбинантных механизмов молекулярной биологии. (Дэвис, 1996) "Микровенус" представляет собой графический символ (наподобие наложенных друг на друга букв "Y" и "I"), закодированный в нуклеотидную последовательность ДНК. Эта последовательность была синтезирована в Гарварде при участии Мартина Боттфилда; полученные синтетические олигонуклеотиды очищены Даной Бойд в Беркли и затем в Гарварде легированы с плазмидными векторами pUC19 и pSK-M13+. В результате лабораторные штаммы бактерии E. coli были трансформированы рекомбинантными плазмидами, содержащими заданный синтетический фрагмент. "Микровенус" стала первой из целого ряда художественных работ, созданных с привлечением стремительно развивающихся технологий и направленных на исследование возможностей кодирования необходимой информации в ДНК. Для того чтобы закодировать выбранный графический знак, мы задали ряд фазовых значений, соответствующих каждому из четырех оснований ДНК (C=x; T=xx; A=xxx; G=xxxx). Данный метод мы совместили с растровой технологией изображения на основе чисел Цермело, использованной Дрейком и Саганом при составлении послания Аресибо. "Микровенус" была закодирована в 35-битный (7 на 5) растр Цермело в следующей последовательности:

10101 01110 00100 00100 00100 00100

Art work allows the user to listen particular living cells microacoustic signatures

Используя заданные фазовые значения четырех оснований ДНК, число, составляющее данный растр, можно отобразить следующим образом: "CCCCCCAACGCGCGCGCT". Первый двоичный знак слева (верхний ряд) выражается символом "С", потому что это число имеет одну фазу (так как не повторяется непосредственно сразу). До перехода в следующий двоичный знак оно остается в своем значении ("1") один раз. Второй, третий и четвертый знак во втором ряду можно отобразить в качестве основания "А", так как это число ("1") повторяется три раза до перехода в следующий знак. Потом снова идут "А" и "С", а следующие четыре двоичных знака отображаются как "G" и т.д. Таким образом, 35-битовый растр "Микровенус" кодируется в 18 оснований ДНК. Мы также добавили короткую последовательность "CTTAAAGGGG" в качестве декодирующего ключа (относительно заданных фазовых значений оснований ДНК). В результате комбинированная последовательность ДНК "Микровенус" выглядит следующим образом: "CTTAAAGGGGCCCCCCAACGCGCGCGCT". Символ "Микровенус" представляет собой одновременно древнегерманский рунический знак, обозначающий женскую природу Земли и графическое изображение гениталий, которое до сих пор отсутствовало в посланиях внеземным цивилизациям. Поскольку для распространения бактерий "Микровенус" в космосе не было выделено необходимых финансовых средств, проблема заражения внеземной среды земными бактериями не рассматривалась. Однако именно эти бактерии - видимо, в качестве спор Bacillus, - обладают значительными преимуществами перед стационарными (радар) и передвижными (космический корабль) вариантами отправки внеземных сообщений. Независимо от вероятности распространения "Микровенус" или любой другой бактерии-носителя в космосе, загрязнение внеземной среды в настоящее время представляется неизбежным. Звучит забавно, но все космические аппараты, находившиеся в разное время на орбите - Mercury, Gemini, Apollo, Skylab, Space Shuttle - сбрасывали отходы жизнедеятельности человека непосредственно в космос. Они буквальным образом смывали туда свои туалеты. Исследователи космической пыли жалуются на то, что в поисках частиц из внеземного пространства им приходится просеивать остатки мочи и кала астронавтов (во всяком случае, они совпали с лабораторными образцами таковых). А на корабле Space Shuttle вообще пришлось счищать фекалии прямо с иллюминатора. Я воспользовался "поэтическим правом" и назвал эти кольца из замороженных отходов, опоясывающие Землю, "Кольцами Нортона" (для формирования колец, подобных тем, которые опоясывают Сатурн, планетарный объект должен обладать естественными спутниками). Название "Нортон" возникло по ассоциации с ассенизатором Эдом Нортоном, персонажем телевизионного сериала 50-х "Медовый месяц". Загадки жизни В начале 1990-х я выяснил, что еще за 30 лет до создания организма "Микровенус" ученые предпринимали попытки записи посланий в форме ДНК. В двух книгах (Ernst and Lipson, 1988 и Beadle and Baedle, 1966) я нашел краткие упоминания этих малоизвестных эпизодов истории науки. Дело происходило в 1958 году. За пять лет до этого Уотсон и Крик (при участии Розалин Франклин) предложили структурную модель ДНК, но прошло еще десять лет, прежде чем ученым удалось понять устройство генетического кода. Было известно, что аминокислоты кодируются в ДНК кодонами-триплетами, но принципы распределения двадцати аминокислот между 64 возможными нуклеоидными триплетами были открыты только в 1967 году. На промежуточном этапе биологи осознали, что функциональный принцип генетического кода во многом схож с функциональным принципом речи. Триплет-кодон имеет такое же отношение к аминокислоте, которую он представляет, как, например, слово "красный" к феномену или способу восприятия красного цвета. Таким образом, генетический код функционирует так же, как язык в формальном, лингвистическом смысле. Выяснив это, ученые почувствовали себя лириками. В биологических кулуарах несколько лет обсуждался вопрос о том, существуют ли между "словами" "пробелы". Биологи обозначили две противоположных точки зрения - одни придерживались мнения, что код подразумевает наличие "запятой", другие полагали, что нет. Наука в очередной раз достигла своего предела понимания и обнаружила, что там отразился ее собственный язык. В 1958 году, в преддверии церемонии вручения Нобелевской премии в Стокгольме, два ученых - Макс Дельбрюк и Джордж Бидл - обменялись несколькими шифрованными посланиями, построенными по принципу лингвистического функционирования генетического кода. Они заменили буквы английского алфавита позициями аминокислот в коде из 64 элементов (рис. 1). Сообщения Дельбрюка содержали кодоны, соответствующие "запятым" или "пробелам". Бидл придерживался принципа "без запятой". Последним в их "переписке" стало сообщение в форме модели ДНК, собранной из 174 зубочисток разных цветов. Дельбрюк привез модель в Стокгольм, а Бидл расшифровал этот текст во время своей официальной лекции по поводу вручения Нобелевской премии. В модели было зашифровано следующее сообщение: "Я - загадка жизни, познайте меня, и вы познаете себя". Это была "загадка Сфинкса". "Познай самого себя" - известное изречение Аполлона и принцип Дельфийского оракула. Вот почему Сократ так упорно пытался убедить Афины, что он ничего не знает (немало поспособствовав тем самым своей гибели).

Fig.1. Delbruck Riddle of Life RNA code (ABCD=UCAG).

В 1995 году мне пришла в голову идея организовать выставку о "Загадке жизни" в гарвардском Бойлстон Холле. (Надис 1995) Основным ее экспонатом должна была стать модель ДНК 174 "Загадка жизни". В 1958 г. Дельбрюк и Бидл не могли синтезировать реальную ДНК. Фактически, синтез ДНК давался нелегко до середины 80-х, а синтезировать такую большую молекулу, как ДНК 174 "Загадка жизни", было бы довольно сложно без применения полимеразной цепной реакции - метода, который стал доступен биологам только около двух десятилетий назад. Зимой 1993-94 гг. я договорился о проведении работ по синтезу и очистке ДНК "Загадка жизни" в лаборатории Бурхарда Виттига (Свободный университет, Берлин). После этого (1994 г.) мы, совместно со Стефаном Волфлом, собрали и клонировали олигонуклеотиды "Загадки жизни" в бактериях E. coli в лаборатории Александра Рича (Массачусетский технологический институт). Со своей стороны Гарвардский и Кембриджский (Массачусетс) комитеты по биобезопасности дали официальное разрешение на хранение бактерий "Загадка жизни" в рефрижераторе с двойным остеклением, который был специально для этой цели установлен в гарвардском Бойлстон Холле. Накануне выставки журнал "Nature" опубликовал пространную статью о проекте "Загадка жизни", где в частности говорилось о том, что нам удалось выстроить "мост между двумя культурами" науки и искусства. К сожалению, перейти этот мост нам не удалось. (Nadis 1995) Нормы и требования производства и экспозиции генетического искусства В самую последнюю минуту Гарвардский комитет по биобезопасности отозвал свое разрешение на размещение бактерии E. coli "Загадка жизни" в рефрижераторе Бойлстон Холла. Решение было принято, несмотря на недавнюю публикацию в журнале "Scientific American" в разделе "Сделай сам" руководства для исследователей-любителей по получению рекомбинантной E. coli в домашнем аквариуме при помощи лампового инкубатора. Генетически модифицированные организмы "Загадка жизни" были выставлены для публичного обозрения только пять лет спустя на фестивале современного искусства "Ars Electronica" в Линце (Австрия, 2000). (Nadis 2000) Разумеется, были предприняты все необходимые меры биологической и физической защиты под контролем и с разрешения представителей Австрийского комитета биологической безопасности. Художники, работающие с ДНК живых организмов, непременно сталкиваются с большим кругом различных организационных вопросов, касающихся как проблем технического, архитектурного и т.п. характера, так и положений биологической безопасности и контроля состояния окружающей среды, связанных с организацией выставок рекомбинантных организмов. Это в полной мере относится и к деятельности кураторов, устраивающих подобные выставки в общественно доступных местах. Зачастую директоры галерей и музеев не могут или не хотят преодолевать все сложности, возникающие при размещении и публичной демонстрации объектов генетического искусства. Однако проблемы, связанные с безопасностью и ответственностью, все же необходимо решать, если мы хотим адекватно представлять развитие этого художественного направления. Отдельный пункт в организации таких выставок занимает серьезная подготовительная работа с публикой (имея в виду непреходящую массовую истерию по поводу генетических манипуляций), а также с институтами, формирующими общественное мнение по данному вопросу. Данная электронная версия книги "Биомедиале. Современное общество и геномная культура" не полна. Текст без пропусков может быть приобретен в печатной форме в виде антологии. Запрос направлять по адресу: 236000, Россия, г. Калининград, ул. К.Маркса, 18, по телефонам: Калининград (0112)216251, Санкт-Петербург (812)3885881, Москва (095)2867666. Электронный магазин: http://www.yantskaz.ru, Книга-почтой: тел.(0112)216251, все справки по электронному адресу: [email protected] Полная ссылка на данную книгу: "Биомедиале. Современное общество и геномная культура". Составление и общая редакция Дмитрия Булатова. Калининград: КФ ГЦСИ, ФГУИПП «Янтарный сказ», 2004. Любые газы, контактирующие с этими организмами (включая атмосферный воздух), на выходе из здания сжигаются. Таким образом сгорают все патогенные организмы, переносимые воздушным путем.

Joe Davis, Katie Egan. Artistic Molecules & Audio Microscope (installation fragment), 2000. Photo by S. Starmayr. Art work constructed from synthetic molecules of DNA: Audio Microscope allows the user to image particular living cells while simultaneously listening to their greatly amplified - and species-specific - microacoustic signatures. The project Riddle of Life, which likewise works with sequencing and back-translation, takes the poetic message "I am the riddle of life. Know me and you will know yourself."

Но правила обращения с самым опасным живым организмом на Земле имеют свои особенности. Этот организм, уничтожающий по одному биологическому виду ежедневно (а некоторые утверждают, что по одному виду в минуту), называется, конечно, Homo sapiens. Никаких норм по контролю над самими биологами до сих пор не принято. В данной ситуации неважно, насколько биологи придерживаются правил биобезопасности, - художники должны соблюдать их неукоснительным образом. На сегодняшний день не существует никаких специальных норм или протоколов по размещению и контролю организмов, используемых для создания произведений генетического искусства. В итоге многие ученые полагают, что только научные работники умеют должным образом обращаться с рекомбинантным материалом. Однако на самом деле наука не имеет эксклюзивного права на ответственный подход к делу. Нынче художники находятся в полной зависимости от научных лабораторий, так как не могут осуществлять свои творческие замыслы без специального оборудования: к сожалению, независимых лабораторий, производящих рекомбинантные организмы исключительно в художественных целях, пока не существует. Ответственность за распространение организмов вне лаборатории, как правило, лежит на самой лаборатории, которая произвела эти организмы. Поэтому художник также должен быть готов столкнуться с определенными опасениями ученых в отношении осуществления своего генетического проекта. Более того, совершенно очевидно, что художник, работающий в научной лаборатории, должен безоговорочно соблюдать все нормы и правила, иначе доступ к необходимому оборудованию будет для него закрыт.

Fig. 2. Key for a Base-20 Degenerate DNA Supercode.

Геномное искусство За относительно небольшой промежуток времени художники перешли от традиций подражательного воспроизведения реальности к непосредственному манипулированию жизнью. В настоящий момент художественная работа определяется на уровне манипуляций одинарными генами (или их эквивалентами), их экспрессии или размещения в организме-"хозяине". По мере развития самой технологии и понимания сути генетики художники будут более обстоятельно осваивать технический инструментарий и овладевать набором методов молекулярной генетики и биологии. В ближайшем будущем уже появятся художественные произведения, созданные на основе нескольких генов и даже генома в целом. Геном - это крупный резервуар высокоорганизованной информации, обладающий сложной встроенной или самообразующейся системой интерпретации и анализа данных. Поскольку эта система состоит из белков и нуклеиновых кислот, она действует на таком уровне сложности, который не учитывают математические операции, используемые для управления традиционными базами данных. Художественное произведение, состоящее из больших случайно составленных последовательностей ДНК, невозможно автоматически воспроизвести in vivo. Большое число простых повторов одной или нескольких пар оснований ДНК биологически нестабильно. Некоторые последовательности могут обладать свойствами, не только нарушающими стабильность, но и токсичными для клетки-хозяина. Геномное искусство (и даже генетическое искусство) должно обладать способностью кодировать большой объем произвольной информации в "биологически-благоприятные" молекулы ДНК. Для этого существуют суперкоды ДНК.

Joe Davis. She (DNA) is the Primordial Venus. DNAgraphy, 2002. Microscopic images created with biochip technology (Clondiag Biochip Technologies GmbH, Jena) using DNA as photographic "emulsion". The technique allows for photography much as we think of it, but at extremely high resolution. The images are smaller than 1.0 mm.

Суперкоды и ДНК "Млечного Пути" Впервые я разработал суперкод ДНК (рис. 2) в 1995 г. для кодировки карты галактики Млечного Пути в молекулу ДНК. (Davis 2000) Карта Млечного Пути представляет собой цифровой файл объемом 1,1 килобайт, содержащий исследовательскую космическую карту Млечного Пути NASA (NASA COBE), которую можно представить в виде последовательности двоичных цифр. В данном суперкоде для транскрибирования 20 оснований, посредством которых кодируются входные данные (в нашем случае карта COBE), использовано большинство из 64 нуклеотидных триплет. Второй этап кодирования существует для решения биологических проблем, связанных с вводом произвольных данных непосредственно в ДНК. Три стоп-кодона (ТАА, TАG, TGA) представляют собой "переключатели" между различными модулями кодирования, а также устанавливают мононуклеотидные простые повторы, встречающиеся во входных данных. Четыре мононуклеотидных триплета (CCC, TTT, AAA, GGG) определяют соответствующие основания ДНК (C, T, A, G). Суперкод ДНК имеет три последовательности кодирования: 1) TGA используется для обозначения биологически совместимых сегментов вводимых данных, кодируемых непосредственно в ДНК; 2) ТАА используется для обозначения мононуклеоидных повторов, где триплет, инициирующий базовое основание 20, предшествует одному из триплетов, определяющих конкретное основание ДНК; 3) TAG - не кодирующая, "бессмысленная" последовательность, указывающая на то, что она не содержит вводимых данных. Последовательность TAG может содержать участки узнавания в энзимах, необходимые для манипуляции и составления полной последовательности, либо для ввода функциональных генов в целях обеспечения стабильности собранной последовательности in vivo. На первом этапе суперкодирования имеющейся базы данных последовательность ТАА кодирует все стоп-кодоны вводимых данных, которые были непосредственно транскрибированы в ДНК. Все кодоны терминации, введенные в качестве элементов-переключателей последовательности суперкода, будут стерты в процессе декодирования. Кодоны инициации (ATC, GTG, TTG, CTG и т.д.) трансляции вводимых данных биологической структурой клетки хозяина могут быть также зашифрованы в целях предотвращения нежелательного выражения in vivo. Суперкод, как и сам генетический код, является вырожденным с тем, чтобы генерировать большое число последовательностей ДНК, каждую из которых можно было бы декодировать в точном соответствии с исходными данными. Например, в случае ДНК "Млечного Пути", можно генерировать гораздо большее число последовательностей, содержащих карту галактики, чем число звезд, находящихся в самой галактике. На идею создания ДНК "Млечного Пути" меня натолкнула детская сказка об избалованной девочке, которая не могла найти свое счастье, пока не встретила мышку с картой мира в ушке. Первая ДНК "Млечного Пути" была синтезирована в 2002 г. и представлена на художественной выставке "Biologia Como Arte" (Queiroz 2002) в Баркарене, Португалия. Полная последовательность ДНК "Млечного Пути" состоит из 3867 bp молекул ДНК, что превышает размеры ряда плазмид и соответствует размеру некоторых вирусных геномов (например, вирус Phi-X содержит около 5000 пар оснований).** Код умолчания Суперкод ДНК решает многие проблемы, связанные с кодированием объемных баз данных в ДНК, кроме одной и очень серьезной. Организм обычно стремится стереть последовательность ДНК, не обладающую выраженным биологическим смыслом. Вместе с Даной Бойд мы создали код следующего поколения, названный "Код умолчания", который использует вырожденный генетический код для ввода произвольной информации в генную последовательность, не изменяя при этом биологического транскрипта этого гена. Данная электронная версия книги "Биомедиале. Современное общество и геномная культура" не полна. Текст без пропусков может быть приобретен в печатной форме в виде антологии. Запрос направлять по адресу: 236000, Россия, г. Калининград, ул. К.Маркса, 18, по телефонам: Калининград (0112)216251, Санкт-Петербург (812)3885881, Москва (095)2867666. Электронный магазин: http://www.yantskaz.ru, Книга-почтой: тел.(0112)216251, все справки по электронному адресу: [email protected] Полная ссылка на данную книгу: "Биомедиале. Современное общество и геномная культура". Составление и общая редакция Дмитрия Булатова. Калининград: КФ ГЦСИ, ФГУИПП «Янтарный сказ», 2004. Кодоны терминации (TAA, TGA и TAG) и одинарные кодоновые последовательности для метионина и триптофана (ATG и TGG) в "Коде умолчания" не используются (рис. 3). Рис. 3. Код умолчания. amino acid [codon = silent code value] 1) PHE = [ UUU = 0, UUC = 1] 2) LEU = [UUA= 0, UUG = 1; CUU = 10; CUC = 11; CUA = 00; CUG = 01] 3) ILEU = [AUU = 0; AUC = 1; AUA = 00] -) MET = [AUG = X] 4) VAL = [GUU = 0; GUC = 1; GUA = 10; GUG = 11] 5) SER = [AGU = 0; AGC = 1; UCU = 10; UCC = 11; UCA = 00; UCG = 01] 6) PRO = [CCU = 0; CCC = 1; CCA = 10; CCG = 11] 7) THR = [ACU = 0; ACC = 1; ACA = 10; ACG = 11] 8) ALA = [GCU = 0; GCC = 1 GCA = 10 GCG = 11] 9) TYR = [UAU = 0; UAC = 1] -) STOP = [UAA = X, UAG = X; UGA = X] 10) HIS = [CAU = 0; CAC =1] 11) GLN = [CAA = 0; CAC = 1] 12) ASN = [AAU = 0; AAC = 1] 13) LYS = [AAA = 0; AAG = 1] 14) ASP = [GAU = 0; GAC = 1] 15) GLU = [GAA = 0; GAG = 1] 16) CYS = [UGU = 0; UGC = 1] -) TRP = [UGG = X] 17) ARG = [AGA = 0; AGG = 1; CGU = 10; CGC = 11; CGA = 00; CGG = 01] 18) GLY = [GGU = 0; GGC = 1; GGA = 10; GGG = 11] "Код умолчания" содержит гораздо меньший объем произвольно закодированной информации на пару оснований ДНК, чем суперкодированная ДНК, но "Код умолчания" действительно является очень "тихим" в биологическом смысле. Независимо от наличия или отсутствия "Кода умолчания" белковые структуры и взаимодействия, общее количество пар оснований, энергетические потребности клетки-хозяина остаются неизменными. "Код умолчания" - это следующий этап в развитии генного искусства, подразумевающий более высокий уровень организации творчества в этой области. Он дает возможность создать карту мира, которая имеет большее соответствие оригиналу, нежели сам оригинал. Теоретически, при помощи "Кода умолчания" можно зашифровать все геномы всех живых организмов, не изменяя экологии их взаимодействия между собой или экологии окружающей среды в целом. Первым объектом (работа продолжается) кодирования с использованием "Кода умолчания" стал плазмид pSK-M13+. В него введено стихотворение Гете о тишине и смерти ("Ночная песнь странника"): Uber allen Gipfeln Ist Ruh, In allen Wipfeln Spurest du Kaum einen Hauch; Die Vogelein schweigen im Walde Warte nur, balde Ruhest Duauch.*** Перевод с английского Юлии Шпаковой. Библиографию статьи см. в английской версии. (Прим. ред.) * Билатеральный - двусторонний, относящийся к обеим сторонам. (Прим. ред.) ** 3867 bp (base pairs = пар оснований) - этот размер в принципе соотносим именно с размером плазмид; размер же полного вирусного генома составляет около 30 000-50 000 bp. (Прим. ред.) *** Мирно высятся горы. В полусон Каждый листик средь бора На краю косогора Погружен. Птичек замерли хоры. Погоди: будет скоро И тебе угомон. (Перевод стихотворения Б. Пастернака)

Дэвид Kремерс ::: Биография ПАРАДОКС ДЕЛЬБРЮКА ВЕРСИЯ 3.0 мы - первое поколение художников, стоящее перед проблемой не смертности, но бессмертия. благодаря последним достижениям биологических и компьютерных технологий, позволяющим продлевать жизнь, художники ХХI века столкнулись как с отменой их собственной художественной значимости, так и с увеличением того временного отрезка, что входит в понятие исторического контекста. из этой дилеммы цивилизация будет вынуждена создать новое мировоззрение, менее механистичное, чем то, что породила предыдущая индустриальная революция. введение никто больше не умирает. после пришествия фотографии мертвые остаются с нами. возможно, сегодня мэрилин монро, вечно молодая экранная легенда, живет жизнью лучшей, чем жизнь стареющей пьянчужки, каковую она могла бы вести в реальном времени. это оттого, что новые инструменты, например интернет и проект "геном человека", расширили пейзаж, наш образ реальности. от описания предметов в дискретном пространстве мы перешли к наблюдению систем в пространстве отношений. сегодня мы живем в двух мирах, в образном мире, который дан нам в чувственном восприятии, и в концептуальном мире, который дан нам в умственном постижении. оба эти мира основаны на познании, и наши модели их неполны, а возможно и ложны. однако благодаря отсутствию догмы мы можем постоянно улучшать и обновлять их. конечно, это одна из главных причин тому, что люди чувствуют себя так неуверенно. мы не только видим, что мир вокруг нас непрерывно изменяется, но и знаем это. людям еще предстоит открыть для себя способ смотреть на вещи текуче, который позволит нам жить так, словно мы мчимся на гребне этой волны перемен, а не так, словно волна сбивает нас с ног. но, дабы достичь невиданного технологического прогресса - прогресса, о котором нам известно, что он не за горами - мы должны открыть эту новую точку зрения. технология становится больше похожа на садоводство, чем на производство, и, как в садоводстве, урожай не будет полностью нам подконтролен. чтобы войти в струю этого развития, людям придется меньше полагаться на количественный анализ и прогностические модели. чтобы урожай сложных систем жизни оказался богатым, людям придется развивать новые методы, постигая те факторы, что не подлежат простому измерению, а возможно и вовсе неизмеримы. Данная электронная версия книги "Биомедиале. Современное общество и геномная культура" не полна. Текст без пропусков может быть приобретен в печатной форме в виде антологии. Запрос направлять по адресу: 236000, Россия, г. Калининград, ул. К.Маркса, 18, по телефонам: Калининград (0112)216251, Санкт-Петербург (812)3885881, Москва (095)2867666. Электронный магазин: http://www.yantskaz.ru, Книга-почтой: тел. (0112)216251, все справки по электронному адресу: [email protected] Полная ссылка на данную книгу: "Биомедиале. Современное общество и геномная культура". Составление и общая редакция Дмитрия Булатова. Калининград: КФ ГЦСИ, ФГУИПП «Янтарный сказ», 2004. мы стремительно движемся от цивилизации, основанной на манипуляции более или менее неодушевленными предметами, к цивилизации, основанной на порождении более или менее живых организмов.

HITS Daily Double: Rumor Mill

Среда, 24 апреля 2002 г.

Назовите это лысыми амбициями. На этот раз ожидания будут выше, но V2 Records artiste Moby - космический костюм и все такое - готов к вызову.

Его новый альбом, 18 , появится на прилавках 14 мая. Это первый набор нового материала для знатоков мультимедиа после Play в июне 1999 года. После продажи всего 8000 штук за первую неделю, Play собрала внебиржевой рынок 2,1 миллиона. Успех этого диска был вызван тем фактом, что все 18 треков были в конечном итоге лицензированы для коммерческого использования, включая такие хиты, как «Bodyrock», «Honey» и «South Side», дуэт с Gwen Stefani .

Название нового альбома относится к количеству треков на пластинке, хотя Моби намекает, что это добавило значимости любому, «кто бывал в Израиле или знаком с теориями заговора НЛО». В числе гостей Шинед О’Коннор , Мик Геранимо , MC Lyte и Энджи Стоун .

«Не хочу показаться слишком высокомерным, но мне нравится эта запись», - утверждает он. «Это меня беспокоит, потому что обычно, когда я делаю запись, у меня очень смешанные чувства по этому поводу».

Видео на первый сингл «We Are All Made of Stars» было снято Джозефом Каном (новый клип Эминема , Бритни Спирс , DMX ). Он показывает Моби как космического пришельца, который приземляется в Голливуде, где он встречает множество экзотических знаменитостей, включая Тодда Бриджеса и Гэри Коулмана в импровизированном воссоединении Diff'rent Strokes , а также Vern . «Mini Me» Troyer , Corey Feldman , Thora Birch , NSYNC 's JC Chasez , Dave Navarro и Tommy Lee .Видео уже добавлено на MTV Buzzworthy , Vh2 и MTV2 . Сингл был самым популярным на радио PoMo и APM и попал в Top 40 и Hot AC 20 мая.

Сказал промо дом V2 Мэтт Поллак : «Мы решили накормить его базу, и KROQ и WXRT откликнулись. Это насыщенный событиями релиз для нас, и до сих пор атмосфера была отличной ».

Моби говорит, что песня была вдохновлена ​​его интересом к квантовой физике.«На базовом уровне вся материя во Вселенной состоит из звездной пыли», - объясняет он.

V2 обещает сделать все возможное, чтобы продвигать альбом и продвигать его, в том числе:

* Розничная онлайн- и офлайн-акция, предлагающая 18 «Коллекционных арт-карт», разработанных Moby, для всех, кто оформил предварительный заказ альбома. Те, кто заказывает диск, могут сразу же транслировать его через безопасный пароль.

* Moby выступит на Saturday Night Live в финале сезона (18 мая).

* Он появится на Джон Стюарт (5/13), Carson Daly (5/14), Дэвид Леттерман (19.06) и Джей Лено (середина июля).

* MTV’s Seor Moby’s House of Music будет транслироваться каждые две недели по субботам вечером.

* Премьера специального выпуска MTV, Dinner и Moby , состоится 5/10.

* Программа AOL «Первое прослушивание» была запущена в прошлом месяце.

* В магазинах Virgin Megastore (13 мая) и Tower (14 мая) в Нью-Йорке.

* Собственная хэдлайнерская прогулка Моби начинается в июле, за ней следует его второй ежегодный тур Area: 2 , который стартует позже в том же месяце с David Bowie .

* Функции в Spin , LA Times , NY Times , Newsweek , Rolling Stone , Tower Pulse , USA Today , Elle , Esquire , GQ , и т. д.

Менеджер по продукту V2 Рэйчел Минц говорит: «Это самая обширная маркетинговая онлайн-кампания, которую мы когда-либо проводили.

Моби поздравляет Эминема, делает пришельцев пьяными и толстыми

Пацифист электронной поп-музыки Моби в последнее время набирает обороты. Возможно, это как-то связано с опасениями, которые он выражает на своем веб-сайте по поводу враждебных видений поджигателей войны на этой планете. Какой бы ни была причина, он решил снова сосредоточиться на маленьких зеленых человечках в своем видео на "Sunday (The Day Before My Birthday)".

Клип является продолжением сюжета, начатого в его последнем видео "In This World", в котором крошечные инопланетяне спускаются на Землю, чтобы вступить в контакт, но слишком малы, чтобы их мог увидеть кто-либо.Оба были сняты Style War.

«В конце [последнего] видео инопланетяне возвращаются на свою родную планету и делают больший знак», - сказал Моби. «Итак, в« воскресенье »они возвращаются на Землю с большим знаком, и все узнают их. Они становятся знаменитостями и начинают ходить на неряшливые вечеринки со знаменитостями и тусоваться в их ночных клубах».

Конечно, Моби не мог согласиться на видео, которое было просто развлекательным. Он должен был убедиться, что есть какой-то социальный комментарий.

«Пришельцы заключают рекламную сделку, по которой они начинают продавать музыку различным корпорациям», - сказал Моби, лицензировавший каждую песню из своего альбома « Play » 1999 года для использования в рекламе, фильмах и телешоу. «Они все становятся толстыми и пьяными. И в конце они все смотрят друг на друга так:« Ну, что случилось? Мы пришли на Землю и стали ужасными ». Поэтому они возвращаются в свой космический корабль и едут домой, устраивают пикник и играют во фрисби со своей собакой ».

Недавно у Моби появился повод познакомиться с человеконенавистниками.По какой-то причине он стал чем-то вроде боксерской груши для Эминема, а также стал жертвой других неспровоцированных атак, худшее из которых произошло в декабре, когда он был избит после того, как покинул бостонский ночной клуб (см. «Моби избили, залили булавой снаружи»). Бостонский клуб »).

«Судя по всему, друг одного из напавших на меня парней позвонил на радиостанцию ​​и сказал, что это избиение геев, - сказал Моби. "Очевидная ирония состоит в том, что я не гей. Я имею в виду, что я живу в Нью-Йорке и люблю тусоваться в гей-клубах, и многие мои друзья - геи.Но, хорошо это или плохо, я не гей. Так что я испытываю некоторую странную извращенную гордость за то, что являюсь одним из немногих гетеросексуалов в мире, подвергшихся насилию над геями ».

После того, как его избили, Моби высказался о том, что не злится на головорезов, которые его преследовали. Точно так же он утверждает, что не испытывает никаких обид к Эминему, который угрожал ударить его на прошлогодних VMA, говоря: «Я, , ударил человека в очках» (см. «Был ли Эминем вне очереди на VMA, или просто был Реальный? Болельщики (и Триумф) взвешиваются ").Более того, он хвалит вспыльчивого рэпера за успех с фильмом «8 миль».

«Я не видел« 8 Mile », но слышал, что он действительно хорош», - сказал он. "На самом деле я не так часто хожу в кино, но в какой-то момент я могу это увидеть. Я, конечно, не против того, чтобы это увидеть, и все, с кем я разговаривал, говорили, что это действительно действительно здорово Итак, поздравляем Эминема ».

11 великих песен об инопланетянах и НЛО, пришедших из этого мира - Kerrang!

В то время как люди повсюду ищут признаки внеземной жизни, в рок-мире уже есть множество песен о маленьких зеленых (или серых) человечках и их летающих тарелках - или, по крайней мере, о них.Так что наденьте шляпу из фольги, достаньте тот старый плакат «Секретных материалов», спрятанный в вашем шкафу, и тихо пробормотайте себе под нос: «Я хочу верить».

blink-182 - Пришельцы существуют

С чего еще мы могли бы начать, кроме как с классики из "Enema Of The State"? В то время мы все думали, что это тупой, забавный, дурацкий вздор на теоретиков заговора и людей, которые утверждают, что были похищены инопланетянами. Теперь кажется, что Том Делонг все время был смертельно серьезен. Что не делает песню менее классической в ​​стиле поп-панк, но определенно заставляет нас задуматься, насколько ее повествование о похищении основано на реальном опыте.

Megadeth - Ангар 18

Этот шумный металлический гимн, взятый из четвертого альбома Megadeth 1990 года, Rust In Peace, получил свое название из научно-фантастического фильма 1980 года. Фильм рассказывает о правительственном сокрытии после столкновения инопланетного корабля с только что запущенным спутником, в результате чего погиб космонавт. Судя по всему, эта история вдохновила барабанщика Ника Мензу на написание текста песни, но кто знает, вдохновлялись ли его близкие встречи с представителями третьего типа.Возможно нет. Но мало ли.

Роб Зомби - Ну, все трахаются в НЛО

Учитывая, что этот трек взят из шестого альбома Роба Зомби, The Electric Warlock Acid Witch Satanic Orgy Celebration Dispenser, неудивительно, что это даже не самое эпатажное или диковинное название песни шок-рокера. рекорд режиссера 2016 года. Однако его видео достойно компенсирует это. Если вы когда-нибудь хотели увидеть, как выглядит пенис инопланетянина - возможно, - то это хорошее место для начала.Но это симпатичный NSFW, так что лучше смотреть его дома.

Ramones - Zero Zero UFO

Не будем лгать - эта песня с LP 1989 года Brain Drain не может конкурировать с ранней классикой Ramones, такой как Blitzkrieg Bop, Now I Wanna Sniff Some Glue или Sheena Is A Punk Rocker. Тем не менее, это по-прежнему удивительно манерный и броский рассказ о встрече с инопланетянами, исполненный с типичной манерой нью-йоркской панк-группы.Конечно, есть довольно хитрые тексты - « Не похоже, что это из Японии / И из темноты вышел странный человек » - но это все равно весело.

Саксонский - Наблюдая за небом

В то время как инопланетяне могут показаться странным предметом для британских металлических гигантов Saxon, то, как Бифф Байфорд восклицает о возможности жизни на других планетах здесь, полностью убедительно. Он не только упоминает правительственные заговоры, но также указывает, насколько нелепа вероятность того, что Земля станет единственной планетой с разумной жизнью.Его факты могут быть преувеличены - « Пятьдесят миллиардов планет / Должна быть какая-то жизнь », - но если Вселенная действительно бесконечна, может быть, это не так уж и далеко.

Muse - Звездный свет

Конечно же эпичные помпезные рокеры Muse писали о внеземной жизни. В конце концов, это группа, чья музыка звучит так, как будто она была создана в открытом космосе, которая летала на гигантском НЛО под названием - что еще? - Берни на большинстве арен, на которых они играли в своем туре Сопротивления 2010 года, и чей певец Мэтт Беллами предположил, что он, возможно, был похищен инопланетянами в подростковом возрасте.С лирической точки зрения это обычно глупо, но это определенно о похищении, а не просто метафора отношений или чего-то подобного.

Misfits - Я превратился в марсианина

Эта песня была написана в 1982 году, задолго до того, как технологии позволили нам должным образом исследовать Марс. Итак, хотя теперь мы знаем, что на красной планете нет существ (если, конечно, все они не прячутся под землей), Misfits не были в этом уверены. Взятая из их первого полнометражного альбома, это идеальная песня Misfits - глупая, но конфронтационная, абсурдная, но напряженная - которая глубоко погружает (иш) в идею одержимости разумом и убийственного намерения.Кроме того, на обложке изображены три летающие тарелки, чтобы доказать, что они серьезно относятся ко всему этому.

Эйс Фрейли - Space Invader

Сольный альбом человека KISS 2009 года одержим тем, что может лежать там, в великом, бесконечном потустороннем мире, и его заглавный трек рассказывает историю космического захватчика, который, кажется, намеревается не дать людям уничтожить планету. Что, на самом деле, является приятным поворотом в образе злых пришельцев, который сопровождает большинство историй о космических захватчиках. Однако, учитывая, что люди нанесли необратимый ущерб планете, может быть уже слишком поздно даже для космического захватчика Эйса - Ace Invader? - чтобы спасти нас.

Инструмент - Rosetta Stoned

Эта песня из альбома "10,000 Days", выпущенного в 2006 году, представляет собой эпический, почти 15-минутный рассказ о встрече с инопланетянами, в которой больше драматизма, чем в эпизоде ​​"Секретных материалов". Сочетание устного повествования и едких, управляющих гитар, это в значительной степени звук настоящего похищения - и ужасающие последствия - и заставит вас почувствовать, что вас действительно забрали и испытали инопланетяне.Но чего еще можно ожидать от Tool? Ровно…

Coheed And Cambria - Триггер Делириума

Поскольку действие большинства песен Coheed And Cambria происходит в мире Amory Wars - научно-фантастической вселенной, созданной Клаудио Санчесом, - любое их количество может быть в этом списке. Но именно этот трек, действие которого происходит на космическом корабле, имеет наиболее традиционно инопланетный сюжет из всех. В этом нет ничего удивительного, потому что он был вдохновлен и следует сюжету, похожему на «Чужие».Достаточно сказать, что это не дружелюбные космические существа, о которых он поет.

Мэрилин Мэнсон - Диссоциативный

Хотя он удваивается как фантастический альбом распада и экзистенциальный, тревожный взгляд на гибнущее человечество, на поверхности Mechanical Animals - концептуальный альбом об инопланетном мессии по имени Омега, который падает на землю и захвачен злыми людьми . Эта песня переворачивает традиционное повествование об инопланетянах на Земле, раскрывая самые мрачные страхи и опасения Омеги по поводу того, что они навсегда останутся в ловушке на Земле без возможности спастись. Мы знаем, что это такое. О, это также примерно то время, когда Роуз Макгоуэн дала Мэрилину Мэнсону кетамин…

Опубликовано 19 марта 2019 г., 15:00.

Прочитайте больше

42 часа окружающих звуков от Blade Runner, Alien, Star Trek и Doctor Who, которые помогут вам расслабиться и уснуть

Еще в 2009 году музыкант, известный под именем Cheesy Nirvosa, начал экспериментировать с эмбиентной музыкой, прежде чем в конечном итоге запустил канал на YouTube, где он «сочиняет longform space и scifi ambience. Или то, что он иначе называет «снотворными». Нажмите на видео выше, и вы сможете уснуть, слушая окружающий гудящий звук - готовьтесь, поклонников Blade Runner ! - слышен в квартире Рича Декарда. Он работает непрерывно 12 часов.

Вы больше поклонник Star Trek ? Хорошо, попробуйте вздремнуть под шум двигателя на холостом ходу корабля, показанного в Star Trek: The Next Generation. Мистер Нирвоза вычистил образец из шоу и затем зацикливал его в течение 24 часов.Это на один долгий сон.

Или как насчет 12 часов окружающего шума двигателя, создаваемого USCSS Nostromo в Alien?

Наконец, и, возможно, мой любимый, Чизи создал 12-часовой клип из звуков окружающей среды, издаваемых Тардис, машиной времени, прославившейся британским научно-фантастическим телешоу Doctor Who . Но будьте осторожны. Вы можете проснуться, живя в другом месте и времени.

Чтобы узнать больше об окружающих звуках научной фантастики («Звездные войны», «Матрица», «Звездный крейсер Галактика», и т. Д.), Просмотрите этот сверхдлинный плейлист здесь.

Примечание: более ранняя версия этого сообщения появилась на нашем сайте в марте 2017 года.

Хотели бы вы поддержать миссию Открытой Культуры? Пожалуйста, рассмотрите возможность сделать пожертвование на наш сайт. Трудно полностью полагаться на рекламу, и ваш вклад поможет нам продолжать предоставлять лучшие бесплатные культурные и образовательные материалы для учащихся во всем мире.

Также рассмотрите возможность подписки на Open Culture на Facebook и Twitter и , обменивающихся интеллектуальными медиа с друзьями. Или подпишитесь на нашу ежедневную электронную почту и получите ежедневную дозу Open Culture на свой почтовый ящик.

Связанное содержание:

Энциклопедия научной фантастики: 17 500 статей обо всем, что касается научной фантастики, теперь доступны бесплатно в Интернете

10 часов арктических звуков окружающей среды помогут вам расслабиться, медитировать, учиться и спать

Moby позволяет загрузить 4 часа эмбиентной музыки, которая поможет вам уснуть, медитировать, заниматься йогой и не паниковать

Музыка, которая помогает уснуть: композитор-минималист Макс Рихтер, Феномен поп-музыки Эд Ширан и ваши избранные


гулей и похищение пришельцами? У вас может быть сонный паралич! | Саймона Спичака | The Faculty

Нет, это не отрывок из романа ужасов или творческое письменное упражнение. Многие люди во всем мире сообщают об этих потусторонних, жутких проявлениях и посещениях. Этот феномен присутствует почти во всех культурах, вдохновляя большую часть наших мифов об ужасах. Несмотря на различия между культурами, во многих из этих посещений наблюдаются общие тенденции: затрудненное дыхание, чувство удушья и паралич в постели. Эти кошмары наяву являются симптомами сонного паралича . Наш мозг отключает части нашего тела, пока мы спим и мечтаем. Однако иногда что-то пойдет не так.Такое часто случается с нами один или два раза в течение нашей жизни. Однако для немногих, кому не повезло, сонный паралич становится почти ночным явлением.

Есть много документальных фильмов, рассказывающих о сонном параличе. Я связал трейлер The Nightmare (2015) , который показывает обычное проявление Человека-тени.

Это явление присутствует почти во всех культурах, вдохновляя большую часть наших мифов об ужасах. Несмотря на различия между культурами, во многих из этих посещений наблюдаются общие тенденции: затрудненное дыхание, чувство удушья и паралич в постели.

По оценкам, сонный паралич случается, по крайней мере, один раз примерно у 2 из 5 человек! Для большинства людей это происходит всего один или два раза в течение жизни. Вместо того чтобы находиться в бессознательном состоянии сна во время фазы быстрого сна, они находятся в сознании во время сна. Они парализованы и часто переживают то, что они описывают как вторжение в спальню, похищение инопланетянами и множество других ужасающих кошмаров.

Есть несколько стадий сна, которые наш мозг проходит циклически, пока мы отдыхаем.Один из этих циклов называется фазой сна с быстрым движением глаз (REM). Именно в этой фазе мы мечтаем каждую ночь. Сначала это происходит через 90 минут после того, как мы засыпаем, и длится около 10 минут. Сначала мозг проходит через четыре стадии медленного сна.

Когда мы входим в фазу быстрого сна, наши глаза быстро перемещаются в разных направлениях, в то время как остальная часть нашего тела остается неподвижной. Мозг посылает сигналы остальному телу, предотвращая любые толчки или движения, чтобы мы не навредили себе, разыгрывая свои мечты.Эта стадия также характеризуется более высоким уровнем мозговой активности, что приводит к ярким сновидениям. В течение ночи мы циклически пропускаем медленный и быстрый сон, причем каждый последующий цикл быстрого сна длится все дольше и дольше. Обычно последняя фаза быстрого сна может длиться час.

Нейробиологи доктор Патрисия Брукс и доктор Джон Х. Пивер обнаружили, что два нейротрансмиттера отвечают за то, чтобы мы не двигались в фазе быстрого сна. Эти два нейротрансмиттера называются гамма-аминомасляной кислотой (ГАМК) и глицином.

Каждый из этих нейротрансмиттеров похож на ключ, который может поворачивать и активировать определенные замки в мозгу. Эти области расположены в стволе мозга , называемых мостом и мозговым веществом. Эти замки являются рецепторами, которые говорят областям мозга замедлить их срабатывание. Поскольку части мозга с этими рецепторами блокировки участвуют в мышечном контроле, это гарантирует, что наши конечности остаются неподвижными.

Во время быстрого сна участвуют и другие важные области мозга.

  • Супрахиазматическое ядро ​​гипоталамуса: Эта область мозга содержит светочувствительные клетки.Во время сна они действуют как кардиостимуляторы. Это включает в себя координацию других областей нашего мозга и обеспечение соответствующей адаптации других тканей тела.
  • Миндалевидное тело: Эта часть мозга добавляет эмоциональный компонент нашему мозгу.
  • Таламус: Эта часть мозга передает информацию от наших органов чувств во время бодрствования. Пока мы не находимся в фазах быстрого сна, эта часть мозга отключена, отключая внешние раздражители.Однако, как только мы входим в стадию быстрого сна, эта область начинает активироваться, чтобы координировать звук, визуальные эффекты и другие чувства в наших снах. Например, затылочная доля коры головного мозга, отвечающая за наше зрительное восприятие, создает яркие визуальные образы в наших снах.

Эта фаза сна завораживает. Части нашего мозга достаточно бодрствуют, чтобы мечтать, но другие части подавлены настолько, чтобы не дать нам проснуться.

Фото Kinga Cichewicz на Unsplash

Подсчитано, что сонный паралич случается как минимум один раз у 2 из 5 человек! Для большинства людей это происходит всего один или два раза в течение жизни.Вместо того чтобы находиться в бессознательном состоянии сна во время фазы быстрого сна, они находятся в сознании во время сна. Они парализованы и часто переживают то, что они описывают как вторжение в спальню, похищение инопланетянами и множество других ужасающих кошмаров.

Никто не знает, что вызывает паралич сна, хотя он связан с несколькими другими расстройствами, включая генерализованное тревожное расстройство, посттравматическое стрессовое расстройство, панические расстройства и другие нарушения сна. Некоторые люди, страдающие сонным параличом, даже сообщают, что учатся получать удовольствие от переживаний, таких как иммерсивное шоу ужасов.

Хотя нейробиология сна имеет первостепенное значение для того, чтобы узнать больше о сонном параличе, наша культура также играет важную роль. Мозг использует предыдущую информацию, чтобы понять ее. Когда дело доходит до сонного паралича, текущий культурный дух времени сильно влияет на то, какие злоумышленники посещают нас посреди ночи. В разное время и в разных странах люди по-разному переживают одно и то же явление.

Сотни лет назад американцы и канадцы считали, что существа истощают их жизненную энергию по ночам, приписывая сонный паралич вампирам или ведьмам.В последние десятилетия на смену этому пришли похищения инопланетянами и теневые люди. В Таиланде люди сообщают, что их окутало привидение, и они называют свое переживание phǐǐ am . В Иране есть аналогичный опыт под названием Kabus , описанный как тяжелое присутствие, сидящее на груди и удушающее вас.

Сонный паралич даже описан в романе Германа Мелвилла 1851 года «Моби Дик»:

Моя рука висела над покрывалом, и безымянная, невообразимая безмолвная форма или фантом, которому принадлежала рука, казалось, вплотную сидела у моей кровати. Казалось, века складывались в века, я лежал там, замороженный самыми ужасными страхами, не смея отвести руку; но никогда не думал, что если бы я только мог размешать его хоть на дюйм, ужасное заклинание было бы разрушено.

Широкие культурные различия и расстояния отделяют нас от людей в других странах. Несмотря на эти большие фундаментальные различия, мы по-прежнему испытываем те же явления, когда спим. Несмотря на то, что культурные проявления различаются, существует так много сверхъестественного сходства.

Психология человека фундаментально похожа, независимо от того, в какое время и в каком месте вы родились. Наш мозг творит экстравагантные объяснения, основанные на предыдущей культурной информации, чтобы понять мир вокруг нас. Это поистине странное явление унизительно - оно может случиться с кем угодно и где угодно, независимо от того, насколько вы богаты или умны. Это усиливает необходимость понимания другого культурного опыта, чтобы лучше понять биологию сонного паралича.

«Прыгай неудачником, мы собираемся похитить людей!» | Фото Мириам Эспасио на Unsplash

Trump Doll по телевизору с Моби и Самантой Би

Вы можете в это поверить? Стретч Трамп знаменит! Он был не в одном, а в двух телешоу за одну неделю!

Стретч Трамп воспроизводит сцену «Чужого 2» с Сигурни Уивер

Он появился на Full Frontal с Самантой Би в холодном начале «Ужина корреспондентов не из Белого дома».Их реконструкция сцены «Чужих 2», где Рипли, которую играет Сигурни Уивер, обнаруживает ребенка в вентиляционных отверстиях. Саманта Би играла роль тритона, когда она сжимала свою эластичную куклу и пытается убежать.

Сигурни успокаивает Саманту Би, которая признает, что переживает из-за предстоящих выборов 2020 года. Другие известные журналисты, Бекка Трейстер и Кэти Курик, также снялись в камео.

«Я лучше сделаю еще одну переданную по телевидению колоноскопию, чем буду освещать выборы 2020 года», - сказал Курик.

Мы слышим вас об этом, Курик. Где еще появилась наша кукла Stretch Trump ???

Моби использует растянутого Трампа, чтобы справиться с Дональдом Трампом

В реальном времени Вместе с Биллом Махером он объяснил Моби различные способы использования ASMR для борьбы с Трампом.

Когда Махер проинструктировал Моби, что делать с куклой Стретч Трамп, Моби ответил: «Мне нужно?»

Вам нужно посмотреть видео ниже, чтобы узнать, о чем его просили.Махер заставлял людей смеяться, и нам нравилось видеть, как наша фигурка Трампа находит хорошее применение? Нет суждения.

Независимо от того, в какую сторону вы играете, Stretch Trump может быть вашей эмоциональной поддержкой. Дайте нам знать, как вы используете его, чтобы снять стресс и немного посмеяться с #StretchTrump!

Скалолазание, пеший туризм и альпинизм: SummitPost

Подход


Следуйте инструкциям на главной странице Whale Dome, чтобы добраться до основания левой стороны южной стены.Маршрут начинается с левой стороны огромного отщепа (настолько огромного, что вы даже не можете сказать, что это отщеп, когда действительно его видите) вверх по наклонной рампе с двумя параллельными трещинами. Смотрите фото здесь, чтобы увидеть начало маршрута.

Описание маршрута


Маршрут поднимается на вершину Whale Dome на шести веселых веревках. Это считается классическим местом, поэтому начните рано или принесите походный стул и возьмите номер. С некоторым одновременным лазанием (от легкого до умеренного 5.6 местности), маршрут можно было легко пройти в три веревки. Плюс в том, что все страховки будут на удобных и надежных уступах. Схема связывания, которую я здесь имею в виду, будет связывать презентации 1 и 2, презентации 3 и 4 и презентации 5 и 6. Оценки презентаций в книге (рейтинги совпадают в двух перечисленных путеводителях), которые я думал, были немного неточными. Я представлю свою интерпретацию рейтингов ниже. Рейтинг маршрута 5,8 довольно мягкий - всего может быть 2 или 3 хода из 5.8 сталкиваются на всей трассе (на 1-й веревке) и находятся выше хорошего болта. Тем не менее, есть небольшие биения на местности примерно до 5,7. Другими словами, маршрут (опять же мое мнение) мягкий для опытного лидера 5,8 и увлекательное приключение для лидера 5,7. Это только мое мнение - так что не убивайте себя!

Шаг 1: 5,8, 90 футов. Поднимитесь по двойным трещинам и низкоугловой стене примерно на 30 футов. Затем переключитесь на левую боковую щель. Закрепите болт и сделайте несколько 5,8-метровых движений, прерываемых красивыми стойками.Прямо над ними двигайтесь прямо к хорошо выраженному лицу (снова куриные головы). Шаг заканчивается на якоре с двумя болтами и неудобной стойкой чуть выше.

Шаг 2: 5,7, 100 футов. От страховки двигайтесь налево к краю плиты. Можно было лечь на правый бок, но этот вариант выглядел изрядно (огромная трещина, я думаю, слишком большая). Следуйте по тонкой трещине вверх примерно на 20 футов. Вернитесь вправо к избранному лицу. Следуйте за лицом / двугранным углом к ​​красивому выступу с одним крошечным деревом.Страховка с использованием дерева и куриной головы.

Шаг 3: 5,7, 100+ футов. В книге дана оценка 5,6, но я подумал, что этот шаг был таким же «сложным», как и тот, что ниже. Следуйте по лицу и двугранно вверх. Примерно на 80 футах отойдите немного влево от двугранного угла и закрепите болт. Это лазание по фрикционной поверхности является ключевым моментом на поле. Угол отклоняется вверх, и вы можете страховать куриные головы над болтом (вероятно, не так удобно).

Шаг 4: 5,6, 50 футов.Найдите болт с правой стороны на вершине скалы, образующей двугранный угол, по которому вы следовали. Закрепите его и двигайте вверх и вправо на лицо под низким углом. Продолжайте двигаться по диагонали вверх и вправо по легкому лицу, стремясь к красивому «балкону» с помощью двойного болта.

Шаг 5: 5,6, 180+ футов. Книга оценивает этот шаг на уровне 5,7+, но я думаю, что 5,6 более справедливо, поскольку удержания составляют огромных и очень положительные. От страховки двигайтесь вправо и вверх на более крутой склон. Вы можете увидеть болт со станции на высоте около 20 футов.Продолжайте продвигаться мимо болта. Два болта (всего) защищают около 50-60 футов лазания здесь. Вы, вероятно, могли бы попробовать получить здесь орехи между куриными головами, но идти легко (не падайте !!). По мере того, как угол уменьшается примерно на 80 футов над уровнем страховки, вы можете страховать на одной из многих положительных «дамб» (страховка «приклада / подпорка» - вероятно, без снаряжения), когда захотите.

Шаг 6: 4 класс,

Спуск:
Идите к задней части "ручки" вершины. Найдите рэп-якорь с тройным болтом (смотри - якорь как бы обнажен - бедренная страховка?).Раппель с двумя веревками с "задней стороны" построения. Свое веселье, немного свободного спуска по воздуху. Пройдите по оврагу класса 2-3 влево (овраг с левой стороны формации, если вы смотрите на формацию с основания маршрута).

Essential Gear


Стойка среднего и легкого размера с нагрузкой на кулачки, а не на гайки (если вы не планируете распиливать шаг 5 выше, тогда возьмите с собой много гаек, чтобы возиться с ними). Я принес и использовал (дважды) друга №5, но было бы нормально не иметь этого.Я также использовал примерно зеленую камеру Alien (~ 0,3 дюйма). Принесите пригоршню тройных полозьев для привязки курятины. Для спуска понадобятся две веревки (скорее всего).

Интернет-ссылки


Смотрите главную страницу Whale Dome. В частности, у Link 3 есть красивые фотографии Моби Дика.

Другие фотографии маршрута

Просмотреть галерею изображений Moby Dick - 12 изображений

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *